<?xml version="1.0" encoding="UTF-8"?><rss version="2.0"
        xmlns:content="http://purl.org/rss/1.0/modules/content/"
        xmlns:wfw="http://wellformedweb.org/CommentAPI/"
        xmlns:dc="http://purl.org/dc/elements/1.1/"
        xmlns:atom="http://www.w3.org/2005/Atom"
        xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
        xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
        >
<channel>
        <title>Microbiology Archives, an International Journal - Feed</title>
        <atom:link href="https://microjournal.researchfloor.org/sero-prevalence-and-circulating-genotypes-of-hepatitis-c-virus-among-diabetic-patients-attending-federal-medical-center-keffi-nasarawa-state-north-central-nigeria/?view=xml-feed" rel="self" type="application/rss+xml" />
        <link>https://microjournal.researchfloor.org/sero-prevalence-and-circulating-genotypes-of-hepatitis-c-virus-among-diabetic-patients-attending-federal-medical-center-keffi-nasarawa-state-north-central-nigeria/</link>
        <description></description>
        <lastBuildDate>Wed, 08 Jul 2026 05:26:01 +0000</lastBuildDate>
        <language></language>
        <sy:updatePeriod>hourly</sy:updatePeriod>
        <sy:updateFrequency>1</sy:updateFrequency>
        <generator>https://wordpress.org/?v=7.0.1</generator>

<image>
	<url>https://microjournal.researchfloor.org/wp-content/uploads/2024/10/MA-Logo-150x150.png</url>
	<title>Sero-Prevalence and Circulating Genotypes of Hepatitis C Virus Among Diabetic Patients Attending Federal Medical Center, Keffi, Nasarawa State, North Central Nigeria - Microbiology Archives, an International Journal</title>
	<link>https://microjournal.researchfloor.org/sero-prevalence-and-circulating-genotypes-of-hepatitis-c-virus-among-diabetic-patients-attending-federal-medical-center-keffi-nasarawa-state-north-central-nigeria/</link>
	<width>32</width>
	<height>32</height>
</image> 
                        <item>
                        <title>Sero-Prevalence and Circulating Genotypes of Hepatitis C Virus Among Diabetic Patients Attending Federal Medical Center, Keffi, Nasarawa State, North Central Nigeria</title>
                        <link>https://microjournal.researchfloor.org/sero-prevalence-and-circulating-genotypes-of-hepatitis-c-virus-among-diabetic-patients-attending-federal-medical-center-keffi-nasarawa-state-north-central-nigeria/</link>
                        <pubDate>Sat, 05 Apr 2025 05:14:00 +0000</pubDate>
                        <dc:creator>admin</dc:creator>
                        <authors>
                                                

</authors>
                        <guid isPermaLink="false">https://microjournal.researchfloor.org/?p=2328</guid>
                        <abstract language="eng"><p>Frequently, when people have <em>hepatitis C virus</em> infection, diabetes is often not taken into consideration. Surprisingly, these two conditions are much more closely linked than people think. The association in the<em>hepatitis C</em> and diabetes remains unclear and controversial in various publications. In Nigeria, the prevalence of <em>hepatitis C virus</em> in diabetic patients is not well documented. This study aimed is to determine prevalence of <em>hepatitis C virus</em> (HCV) and its circulating genotypes among diabetic patients attend the Federal Medical Center, Keffi, Nasarawa State, Nigeria. Three hundred and ninety-eight (398) blood samples were collected from consenting diabetic patients aged 24-64. These were 231 male patients and 167 female patients. A structured questionnaire was used to gather socio-demographic information from the patients. Blood samples from each participant were tested for HCV antibodies using a rapid test kit and enzyme-linked immunosorbent assay (ELISA). 7 samples tested positive in a rapid test, while 5 were confirmed positive using ELISA. All samples that tested positive for anti-HCV antibodies underwent genotyping using type-specific PCR primers. The prevalence of HCV infection in diabetic patients tested was (1.3%). In diabetis status, male subjects had a higher prevalence of (1.3%) compared to female subjects (1.2%). The gender differences were statistically insignificant (p&gt;0.05). Additionally, the study found that HCV genotypes 2, 3 and 4 were circulating in the population, with genotypes 2 and 4 being more frequent. The major risk factors observed in the study included a history of surgery, blood transfusion, and sexually transmitted diseases. Giving these findings, it is recommended that a larger study be conducted to gather more epidemiological data on the prevalence of HCV among diabetic patients in Nigeria.</p>
</abstract>
                        <fullTextUrl format="html">https://microjournal.researchfloor.org/sero-prevalence-and-circulating-genotypes-of-hepatitis-c-virus-among-diabetic-patients-attending-federal-medical-center-keffi-nasarawa-state-north-central-nigeria/</fullTextUrl>
                        <fullhtmlContent><![CDATA[
<ol class="wp-block-list">
<li><strong>Introduction</strong></li>
</ol>



<p class="wp-block-paragraph"><em>Hepatitis C virus</em>, belongs to thefamily Flaviviridae, a single-stranded RNA virus with positive sense. It causes liver inflammation and it is estimated that over 58 million people worldwide are living with HCV. In developed countries, the prevalence of HCV is usually around 1 to 2%. [1] <em>Hepatitis C virus</em> (HCV) and diabetes are significant global health concerns of high morbidity and mortality rates, especially for the developing countries[2]. There isclose association between hepatitis C virus and diabetes, with diabetes often reported as a complication of HCV infection [3]. Diabetes, especially mellitus, has been found to alter the course of hepatitis C even in the insulin resistance (IR) stage, which precedes the development of overt diabetes [2]. This is because the virus affects the liver, which plays a role in storing glucose. If the liver cannot function properly due to viral damage, it can result in high blood sugar levels and insulin resistance [4]. Hepatitis C is an infection that causes inflammation of the liver, it can either be an acute or chronic illness, that can be fatal [5]. The Hepatitis C virus is normally transmitted through contact with the blood of a person infected by the virus; this is generally possible via sharp objects, sexual intercourse, and childbirth [6].Acute hepatitis c is a short-term illness lasting for about six months, after which, the body naturally (for some people) gets rid of it without them noticing, they are usually asymptomatic and do not usually lead to serious health problems, while chronic hepatitis c infection (for most people) up to 85% takes from six months and above, leading to lifelong phase,causing severe health issues like liver cancer and cirrhosis.There are many types of hepatitis c infection, known as genotypes. There exist seven genotypes and sixty-seven sub-types. Chronic hepatitis c takes the same pattern regardless of the type of genotype [7].</p>



<ul class="wp-block-list">
<li><strong>Materials and Methods</strong>
<ul class="wp-block-list">
<li><strong>Study population</strong></li>
</ul>
</li>
</ul>



<p class="wp-block-paragraph">The study subjects includs both in- and out-diabetic mellitus patients of both gendersfrom within Keffi town and the surrounding villages who were accessing medical care at Federal Medical Centre Keffi.</p>



<ul class="wp-block-list">
<li><strong>Study design</strong></li>
</ul>



<p class="wp-block-paragraph">The study was cross-sectional study involve the both male and female diabetic adult patients. Each participant’s consent was sought and socio-demographic and clinical information were obtained using a structured questionnaire.</p>



<ul class="wp-block-list">
<li><strong>Ethical consideration</strong></li>
</ul>



<p class="wp-block-paragraph">Ethical clearance to conduct this study was sought from the Ethical Review Board/Ethical Committee of the Federal Medical Center(FMC)Keffi.</p>



<ul class="wp-block-list">
<li><strong>Sample collection</strong></li>
</ul>



<p class="wp-block-paragraph">The chemical pathology unit of the laboratory was used as the collection point. A total of 398 blood samples were collected from consenting patients. The samples were collected by venipuncture.</p>



<ul class="wp-block-list">
<li><strong>Sample processing</strong></li>
</ul>



<p class="wp-block-paragraph">To obtain serum, each blood sample was allowed to stand for 15-30 minutes and centrifuged at 3000rpm (revolution per minute) for 10minutes at 37<sup>o</sup>C. The sera were harvested and transferred into labeled cryovial tubes for storage. All samples were stored at minus 15<sup>o</sup>C in the Chemical Pathology unit freezer of FMC Keffi until ready for use.</p>



<ul class="wp-block-list">
<li><strong>Laboratory Analysis</strong></li>
</ul>



<h2 class="wp-block-heading">2.4.1 Screening for Anti-HCV</h2>



<p class="wp-block-paragraph">The Biopanda HCV Rapid test kit(BiopandaDiagnostic, United Kingdom) was used, for the screening of HCV according to the manufacturer’s instructions. It is a rapid test kit for the anti-HCV antibodies</p>



<p class="wp-block-paragraph"><a><strong>2.4.2 Screening for Anti-HCV using ELISA</strong></a></p>



<p class="wp-block-paragraph">Qualitative detection of antibodies of hepatitis C virus in human serum, which is based on the Enzyme Linked Immunosorbentmethod was carried out using an anti-HCVELISA test kit(Qingdao Hightop Biotech Co., Ltd.) according to the manufacturer’s instruction.</p>



<h2 class="wp-block-heading"><a>2.4.3 Test Procedure</a></h2>



<p class="wp-block-paragraph">The anti-HCV test reagents were allowed to equilibrate to room temperature for more than 15minutes. The wash buffer was diluted at the rate of 1:40 dilution by adding 5 µL of wash buffer to 5µL of distilled water. Labeled test serum samples from the diabetic patients corresponding were dropped into the wells in the 96 microtitre plate. Each microtitre plate of 96 wells had two negative control wells, a positive control well, and a blank control well. One hundred microlitres (µL) of buffer solution for HCV antibodies (sample diluents) was added in the corresponding wells in the microtiter plates (except in the blank well, negative control wells, and positive control wells).10µL of the serum samples were added in the corresponding well and then mixed thoroughly by using the pipette. Negative control (100µL) and positive control (100µL) were added to the negative control wells and positive control wells (except in the blank well) respectively. The plate was gently shaken to mix and incubated at 37<sup>0</sup> C for 60 minutes. At the end of the first incubation, the plate cover was removed and discarded. Tris-buffered saline with 0.1% Tween <sup>®</sup> 20detergent (Wash buffer) was added to each well, and allowed to stay for 20 seconds before the content was tipped out and tapped on bloating paper to remove excess material in the wells, this washing procedure was repeated 5 times. After washing cycle, microtiter plate was turned over onto blotting paper, tapped to the further remove the material. Fifty µL of Enzyme conjugate was added (except in the blank well) and the plates were properly sealed and incubated at 37<sup>0</sup> C for 30 minutes. Washing with wash buffer was done repeatedly 5 times. Chromogenic substrates A and B (50µL each) were added (except in the blank well) and then incubated at 37<sup>0</sup> C for 30 minutes. Fifty µL of Sulfuric acid (Stop Solution) was added to each well (except in the blank well). It was then gently shaken to mix and the optical density (OD) was read within 10 minutes<a>.&nbsp;&nbsp;&nbsp;&nbsp;</a></p>



<h2 class="wp-block-heading"><a></a><a>2.4.4 Determination of HCV Genotypes by Nested PCR</a></h2>



<p class="wp-block-paragraph">Two‑step nested reversetranscriptase polymerase chain reaction (RT‑PCR) for HCV detection and genotyping [8-9] was used.</p>



<h2 class="wp-block-heading"><a>2.4.4.1 Polymerase Chain Reaction</a></h2>



<p class="wp-block-paragraph">Using the AccuPowerHotStart PCR PreMix PCR kit by Bioneer Inc. USA., the product of the first amplification reaction of the test samples was used as the template for the second PCR. During this second PCR, four PCR tubes were labelled and 16µl of PCR-graded water (DH<sub>2</sub>O) was added into each tube and 2µl of the first round PCR product which served as the template, was added followed by the addition of 2µl of the second primer KY78 and KY80 (5&#8242;- GCAGAAAGCGTCTAGCCATGGCGT -3&#8242;) and (5&#8217;CTCGCAAGCACCCTATCAGGCAGT -3&#8242;) was added to each of the tubes containing the product of first PCR. This is to amplify a 244-nucleotide region of the 5′ untranslated conserved region (UTR) of the HCV genome. Thermo cycler (PTC – 100TM MJ – Research, INC, Peltier) conditions were set as follows; initial PCR activation steps for 5 minutes at 94<sup>o</sup>C, pre-denaturation for 30 seconds at 94<sup>o</sup>C; denaturation for 30 seconds at 60<sup>o</sup>C, annealing for 30 seconds at 72<sup>o</sup>C and extension for 30 seconds at 94<sup>o</sup>C (35 cycles were performed by going back to step two) and final extension for 5 minutes at 72<sup>o</sup>C.</p>



<h2 class="wp-block-heading"><a>2.4.4.2 Gel Electrophoresis and Visualization</a></h2>



<p class="wp-block-paragraph">The PCR products of the 3 reactions were confirmed on 2% agarose gel, visualized under UV light. The gel was prepared by weighing 2.2g of agarose (QD LE Agarose, Green BioResearch, USA) into 100mL of 1X Tris Acetate EDTA(TAE) buffer in a conical flask. The slurry was heated in a microwave for two minutes to properly dissolve the agarose. The solution was then allowed to cool to 60<sup>0</sup>C. Ethidium bromide stain-intercalating agent (12μL) was added and mixed thoroughly by rocking. The casting of the molten gel was done by placing a comb on the mold and then gently pouring the molten agarose into the mold. The gel was allowed to solidify for 30 minutes after which the comb was removed to create wells for the molecular weight ladder and the amplified DNA samples. The tray together with the solidified gel placed in the electrophoresis tank. A 25bp DNA molecular weight marker of 6μL was loaded into the first wells to enable size estimation of the resolved bands. About 100 mL TBE buffer was then poured into the tank to cover the cast.&nbsp; Five microlitres of the PCR products (DNA) were then loaded slowly into their respective wells in the submerged gel. The electromotive force was applied to the gel and was run under a constant voltage of 120 for the 30 minutes. After 30 minutes, gel was removed from gel-box, an excess buffer from surface of gel was drained off and gel tray was placed on the paper towels to absorb extra running buffer. The separated DNA fragments in gel were visualized by illumination with UV light and the pictures were taken with gel documentation system (Gel Doc 2000, BIORAD, USA) and to determine 244bp of the untranslated conserved-region.</p>



<h2 class="wp-block-heading"><a></a><a>2.5 Statistical Analysis</a></h2>



<p class="wp-block-paragraph">The ata entry and statistical analysis were performed with (SPSS) (SPSS, Inc., Chicago, IL). The descriptive data were presented as simple summaries in tables, frequencies, and bar charts. The chi-square test was used where appropriate to establish statistically significant differences between participants, variables and prevalence rates. Probability values (p-values) ≤ 0.05 were considered significant.</p>



<p class="wp-block-paragraph"><strong>3</strong>. <strong>Results</strong></p>



<p class="wp-block-paragraph">The study participants comprised 231 males (58.0%) and 167 females (42.0%) with male.The ages of participants ranged between 24-79 years, more than half 65.3%of them were married. Regarding educational status, most of them 45.5%had secondary education. About half of the participants 50.3% were farmers, 18.3% were civil servants. 15.1% were businessmen and women, 3.8%were housewives, 2.5% in other occupations (Table 1).</p>



<p class="wp-block-paragraph">Clinical history revealed that 20.6% of them have had a blood transfusion, 26.4% had STD, 13.6%had tattooedand 13.6% had surgery. When stratified based on social factors, 223 patients representing 56.0% had single sexual partners while 24.6%, 13.8%,and 5.5%had 2, 3, and multiple sexual partners respectively. Only 1.0% of the participants smoke. About 51.5% of them residein rural areas, 34.9% in urban areas; and 13.6% in other settlements (Table 2).</p>



<p class="wp-block-paragraph">The 398 participants screened for HCV using RDT and ELISA, eight and five representing a prevalence of 2.0% and 1.3% respectively were positive (Figure 1). In relation to gender, 1.3% of the males tested positive while 1.2% of the females were found to be positive, there was no significant association between gender and prevalence of HCV in this study (p&gt;0.05) (Table3).<br></p>



<p class="wp-block-paragraph">An examination of the age distribution of diabetic patients, as presented in Table 3, showed that out of the five age groups categories investigated, participants aged 44-53 and 54- 63 years were all negative for Hepatitis C. However, 2(2.9%) ofthe patients in the age group 24-33 years,2(3.7%)in the age group 34 – 43 years, and 1(0.9%) in the group age 64respectively were positive for Hepatitis C.</p>



<p class="wp-block-paragraph">With the participants’ educational status, particularly those with primary and secondary education, the sample showed that all tested negative for the virus. However, 4(4.8%) participants who had non-formal education were positive for it, and it was the highest recorded HCV infection. All categories of workers had at least one infection each(Table 3), to identify high-risk groups and understand the epidemiology of HCV infection within the diabetic patient population, participants were screened based on clinical risk factors. Results from Table 4 showed that patients with a history of blood transfusion reported a prevalence of 1.2%, patients with a history of surgery recorded a prevalence of 7.4%, patients with a history of sexually transmitted disease reported a prevalence of 3.8%, and those with tattoos recorded 1.9%, positivity for HCV infections, subjects were examined to understand the distribution and complex interplay between social lifestyle factors and HCV infection in the context of diabetes patients. Results from Table 5 showed that subjects with a history of smoking recorded 25.0% positivity, and those with multiple sexual partners had 2.2%positivity to HCV infection. The relationship between number of sexual partners (P= 0.001) and smoking (P = 0.049)were risk factors for HCV infection.Agarose gel electrophoresis shows different HCV genotypes 2, 4, and 3 respectively. (Plates 1 and 2).<br><strong><br></strong></p>



<ul class="wp-block-list">
<li><strong>Discussion</strong></li>
</ul>



<p class="wp-block-paragraph">The participants were first screened the HCV antibodies with the help of rapid diagnostic strips followed by ELISA. Seropositive cases were genotyped by polymerase chain reaction and gel electrophoresis. Of the 398 participants, 2.0%were positive for using rapid diagnostic test strips while 1.3% was seropositive using the ELISA method.Threepreviously positive samplesusing RDT were found to be negative using the ELISA technique. This suggests that ELISA is the more sensitive technique; this is a serious source of concern as the majority of labs use only the rapid technique for diagnoses.</p>



<p class="wp-block-paragraph">The seroprevalence of hepatitis C in the current study was 1.3%, similar to studies reported in Enugu and Ibadan Nigeria with a prevalence of 1.0% [10] and 0.9% [11]. It is however lower when compared to the work of[12] in Enugu where the HCV occurrence rate among diabetic patients was found to be 14.4%. [13] reporteda higher prevalence of 3.0% among blood donors in MasakaNasarawa State.[14] also reported24.2% among diabetic patientsattending the University of Ibadan Teaching Hospital. However, [15] reported a lower prevalence of 0.7% among diabetic patients in Lagos. Studies in other parts of the world like that of [9] and [16] reported a high prevalence of 8.0% and 5.7% in Asia respectively. Differences in the prevalence rate of HCV obtained from various regions globally depict geographical diversity, which can be ascribed to exposure to various risk factors thatcan enhance the spread and transmission of this virus among individuals. Similarly, it could also be a result of the different sensitivities of the test kits used for screening participants.The prevalence rate of HCV infection among males was 1.3%while the female gender had 1.2%sero-positivity. This finding is in line with the result [11] where the prevalence of anti-HCV among diabetic-males wasclose to that of the females. A similar occurrence in both sexes shows that gendermay not be an attributed risk factor for HCV infection in diabetic patients.The prevalenceof HCV infection (3.7%) observed amongst subjects aged 34-43 years, was the highest in this study. This findingfollows that of [10] where the seroprevalence of HCV increasedin older participants and it was significantly higher in the group aged 31-40years which is almost similar to the results obtained [17] showed a higher prevalence rate among patients aged 35-44yearsthereby concurring with the result obtained in this study. The high seropositive observed in the older age group could be attributed to possible differences in social practices, decrease in physical mobility, decline in immune resistance to infections, and reduced rate of medical examination compared to younger age groups.</p>



<p class="wp-block-paragraph">The educational background of the subjects screened showed that 4.8% of individualswith non-formal education are positive for the virus infection.This is similar to the work [18] which recorded 4.6% prevalence. The reason for this could be as a result of non-adherence to preventive measures. It could also be because they are ignorant of the availability of materials that propagate knowledge about prevention and control. Similarly, participants with multiple sexual partners as well as those with a history of STD had the highest seropositive index, since HCV can be sexually transmitted it is not surprising that prevalence is higher among those with a history of STD and multiple sexual partners. This is similar to an earlier report of a study [19], who reported people with multiple sexual partners as being a high-risk group of infection by HCV. The viral infection is known also to be sexually transmitted so multiple partners will naturally increase the probability of getting infected.The HCV being a blood-borne virus, the seroprevalence among individuals who had undergone blood transfusion was not statistically significant and this agrees with the work [20]. Among subjects that had a history of blood transfusion in this study, only 1.2% was found to be positive for HCV infection, it is known that blood and blood products are potential sources of transmission for HCV infection [21]. This may also suggest that transfused blood is usually properly screened for certain blood-transmissible viruses before use. The national guideline for the prevention care and treatment of viral hepatitis in Nigeria [22], requires a confirmatory test with HCV RNA after a positive antibody serology before the commencement of treatment. It could also be a reflection of the relatively low prevalence of the virus in eligible blood donors.A high rate of HCVinfection was equally observed in participantswitha history of surgery, tattoo/facial, and marks. Prevalence rates ranged from 3.8%, 1.9%, and 7.4% respectively,this finding was in contrast to an earlier report [21] which shows that risk factors for HCV were obscure in Nigeria, although that study conducted in another geographical zone in Nigeria. The results of this study revealed the presence of genotypes 2,3 and 4. This agrees with the review study by [8] which shows that all the major genotypes except genotype 6 are present in Africa.&nbsp; They also showed thepresence of mixed genotypes in Africa. Until recently, it was not necessary to determine the genotype of the infecting virus before the commencement of treatment, Accurate HCV genotyping is important for predicting the response to antiviral therapy since genotypes 1 and 4 respond poorly to interferon than genotypes 2 and 3 [23,24,25].</p>



<ul class="wp-block-list">
<li><strong>Conclusion</strong></li>
</ul>



<p class="wp-block-paragraph">This study aims to determine the seroprevalence of hepatitis C virus infectionamong diabetic patients at Federal Medical Centre Keffi, Nasarawa State. This current studies recorded an overall seroprevalence of HCV among diabetic patients at FMC to be 1.3%, 1.3 may not be statistically significant as reported, compared to the number of samples collected at the beginning of this study, but also, confirms that diabetes can be caused by hepatitis C virus and, no matter how insignificant the percentage may be statistically, it is still human lives we are talking about, therefore, there is cause for alarm as HCV is never considered when a patient is being confirmed to be diabetic. This is possible because the hepatitis C virus is known to infect the liver, the liver is also responsible for the storage of excess glucose (blood sugar) in the blood for later, once the liver is impaired or damaged due to this viral infection, it may not be able to carry out its normal function, thereby, leading to the high sugar level in the blood, these studies confirm that patients who tested positive for HCV are often ignorant of the fact that they need to go for further tests (ELISA and Molecular) to confirm the earlier result and the genotypes responsible for the infection for proper treatment, the statistically significant risk factor in this study shows that HCV infection can be prevented if the general public is cautious of the dangers and causes of HCV infection.</p>



<p class="wp-block-paragraph"><strong>6 Conflict of Interest statement</strong></p>



<p class="wp-block-paragraph">The authors declare no conflicts of interest</p>



<p class="wp-block-paragraph"><strong>REFERENCES</strong></p>



<ul class="wp-block-list">
<li>Schwoerer, M. P &amp;Ploss, A. (2022). Barriers to Hepatitis C Virus infection in mice<em>. Current opinion in virology</em>. 56:101273.</li>



<li>Amal, M. A., Elbedewy T.A., Elserafy M., ELTourkly N., Ahmed, W., &amp; Ali, I. A. (2015). Hepatitis C Virus infection: A global view<em>.world Journal of hepatology</em>. 7(26):2676-2680.</li>



<li>Drazilova, S., Gazda, J., Janicko, M. and Jarcuska, P. (2018). Glucose metabolism changes in patients with chronic Hepatitis C treated with direct-acting antivirals.<em>Canadian Journal of Gastroenterology and Hepatology.</em> 10(1): 1 – 12</li>



<li>Blum, H. E. (2016). History and Global Burden of Viral Hepatitis. <em>Digestive diseases.</em>34(4): 293–302</li>



<li>World Health Organization. (2024). Guidelines for the screening, care and treatment of persons with hepatitis c infection. <em>Guidelines</em>, (April), 124</li>



<li>Centers for Disease Control and Prevention (CDC) (2024). Said-Salim B, Mathema B, Kreiswirth BN.  Hepatitis C virus infections in immigrant populations: an emerging problem. <em>Infection Control and Hospital Epidemiology</em>. 24: 451–455</li>



<li>Murphy, D. G., Sablon, E., Chamberland, J., Fournier, E., Dandavino, R. &amp; Tremblay, C. L. (2015). Hepatitis C virus genotype 7, a new genotype originating from central Africa. <em>Journal of Clinical Microbiology</em>, <em>53</em>(3), 967–972</li>



<li>Hanafiah M. K., Flaxman G.F., Wiersma, S. T., Bichi I. A., &amp;Okeke, I.. (2013).Global epidemiology of Hepatitis C Virus infection: new estimates of agespecific antibody to HCV Seroprevalence:<em>Hepatology</em>. 57(4):1333-1342</li>



<li>Gray, H., Wreghitt, T., Stratton, I. M., Alexander, G. J., Turner, R.C. &amp;O’Rahilly, S. (1995). High prevalence of hepatitis C infection in Afro-Caribbean patients with type 2 diabetes and abnormal liver function tests. <em>Indian Journal Endocrinology and Metabolism </em>12, 44–249</li>



<li>Eke C.B., Ogbodo S.O., Muoneke V. U., Ibekwe R.C., &amp;Ikefune A.N. (2016). Seroprevalence and correlates of Hepatitis C Virus Infection in Secondary School in Enugu. <em>Annals of Medical and Health Science Research</em>.6(3)156–161</li>



<li>Okonko, I., Adepoju, A., Okerentungba, P., Nwanze J. &amp;Onuh, C. (2015). Detection of Hepatitis C Virus Antibodies among Children in Ibadan South Western Nigeria.<em> Journal Gastroenterology</em>. 11: 1-8</li>



<li>Nwokediuko, S. C., (2011) Chronic hepatitis B. Management challenges in Resource poor countries. <em>Hepatitis Monthly</em>11 (10): 786-793</li>



<li>Pennap, G.R.I, Nuhu, I.I., &amp;Oti, V.B. (2017). Prevalence of Hepatitis C Virus infection among people attending a voluntary screening centre in Masaka, Nasarawa state, Nigeria. <em>The Asia Journal of Applied Microbiology</em>. 3(3):31-37</li>



<li>Ndako,J.A.,Echeonwil G. O., Shidali, N. N., Bichi I. A., Paul. G.,Onovoh,E.M., Okeke. L. A., (2009) Occurrence ofHepatitis C Virus antibodies among Diabetic patients attending Plateau State Specialist Hospital Jos Nigeria. <em>VirologyJournal.</em>;6 (98): 542-546</li>



<li>Onyekwere, C. A. and Hameed, L. (2015). Hepatitis B and C virus prevalence and association with demographics: report of population screening in Nigeria. <em>Tropical Doctor</em>, <em>45</em>(4), 231–235.</li>



<li>Demitrost L, Ranabir S. (2012) Thyroid dysfunction in type 2 diabetes mellitus: A retrospective study. <em>Indian Journal Endocrinology Metabolism</em>.; 16(2):S334–335</li>



<li>Faeji, C.O. &amp;Omilabu, S. (2015). Molecular and Phylogenetic Analysis of Hepatitis C Virus and Its Implication in Lagos State. <em>International Journal of Virology and Molecular Biology</em>, 4(1): 4-11</li>



<li>Ndako,J.A.,Nwankiti,O.O., Onovoh,E.M., Adekeye,A.E.,Choji,T.P.,Alesa,M.U&amp;Alarape,A.J. (2011) Screening response to Hepatitis C Virus antibodies among Diabetic patients attending UITH Nigeria. <em>Current Research Journal of Biological Sciences</em>.;3 (6): 542-546</li>



<li>Atsbaha, A. H., AsmelashDejen, T., Belodu, R. (2016). Sero-prevalence and associated risk factors for hepatitis C virus infection among voluntary counseling testing and anti-retroviral treatment clinic attendants in Adwa hospital, northern Ethiopia. <em>Biomedical Central Research Notes</em>.<em>9</em>, 121. doi.org/10.1186/s13104-016-1936-3</li>



<li>Bello, S. I. &amp;Erah P. O. (2020). Incidence of Hepatitis C Virus infection among students in public tertiary institution in North Central Nigeria<em>. Nigeria Journal of Pharmaceutical and Applied Science Research</em>. 8(3): 8-14</li>



<li>Okoh, A. M., Aremu O. &amp; Suleiman, I. A. (2022). Prevalence and Knowledge of Hepatitis C Virus infection among residents in Otukpo town, Benue State, North central Nigeria<em>. Journal of Current Biomedical Research</em>. 2(4):255-269</li>



<li>Ministry of Health. (2016). Abuja Nigeria National Guidelines for the prevention, care, and treatment of viral hepatitis in Nigeria. Accessed September 8,2019.</li>



<li>Ali, S., Ahmad, B., Ali, I., Mahmood, N., Anwar, N., Saeedi, I., &amp;Afridi, J. Z. (2016). Virological response to l conventional interferon therapy combined with Ribavirin against various HCV genotypes in Khyber Pakhtunkhwa, Pakistan. <em>Asian Pacific Journal of Cancer Prevention,</em> 17(5): 2407–2410.</li>



<li>González-Grande, R., Jiménez-Pérez, M., González Arjona, C. &amp;Mostazo Torres, J. (2016). New approaches in the treatment of hepatitis C. <em>World Journal of Gastroenterology</em>, <em>22</em>(4): 1421–1432</li>



<li>Kowdley, K. V., Nelson, D. R., Lalezari, J. P., Box, T., Gitlin, N., Poleynard, G., Rabinovitz, M., Ravendhran, N., Sheikh, A. M., Siddique, A., Bhore, R., Noviello, S. &amp;Rana, K. (2016). On-treatment HCV RNA as a predictor of sustained virological response in HCV genotype 3-infected patients treated with daclatasvir and sofosbuvir. <em>Liver international: official journal of the International Association for the Study of the Liver</em>, <em>36</em>(11); 1611–1618</li>
</ul>
]]></fullhtmlContent>
                        
                        <keywords language="eng">
                                                        
                                                            
                                <keyword>1</keyword>
                                                            
                                <keyword>3</keyword>
                                                            
                                <keyword>4-Oxadiazole</keyword>
                                                            
                                <keyword>Abattoir</keyword>
                                                            
                                <keyword>advanced technology</keyword>
                                                            
                                <keyword>Age at First Sex</keyword>
                                                            
                                <keyword>Agriculture</keyword>
                                                            
                                <keyword>agroforestry</keyword>
                                                            
                                <keyword>AI</keyword>
                                                            
                                <keyword>Algae</keyword>
                                                            
                                <keyword>Amended</keyword>
                                                            
                                <keyword>ampicillin</keyword>
                                                            
                                <keyword>Amsel’s criteria</keyword>
                                                            
                                <keyword>Analytical Profile Index</keyword>
                                                            
                                <keyword>Annona muricata</keyword>
                                                            
                                <keyword>Anthropogenic</keyword>
                                                            
                                <keyword>Anti-microbial</keyword>
                                                            
                                <keyword>Antibacterial activity</keyword>
                                                            
                                <keyword>Antibacterial properties</keyword>
                                                            
                                <keyword>Antibacterial property</keyword>
                                                            
                                <keyword>Antibiogram; borehole water; Molecular characterization</keyword>
                                                            
                                <keyword>Antibiotic</keyword>
                                                            
                                <keyword>Antibiotic Resistance</keyword>
                                                            
                                <keyword>Antibiotics</keyword>
                                                            
                                <keyword>antibiotics resistance</keyword>
                                                            
                                <keyword>Antifungal activity</keyword>
                                                            
                                <keyword>Antifungal susceptibility</keyword>
                                                            
                                <keyword>Antimicrobial</keyword>
                                                            
                                <keyword>Antimicrobial activity</keyword>
                                                            
                                <keyword>antimicrobial agents</keyword>
                                                            
                                <keyword>antimicrobial resistance</keyword>
                                                            
                                <keyword>antimicrobial sensitivity testing</keyword>
                                                            
                                <keyword>Antimicrobial susceptibility</keyword>
                                                            
                                <keyword>Antimicrobial therapy</keyword>
                                                            
                                <keyword>Antioxidant</keyword>
                                                            
                                <keyword>Aqueous plant extracts</keyword>
                                                            
                                <keyword>as Escherichia coli</keyword>
                                                            
                                <keyword>atmospheric CO₂ mitigation</keyword>
                                                            
                                <keyword>autotrophic microorganisms</keyword>
                                                            
                                <keyword>baby weighing scales</keyword>
                                                            
                                <keyword>Bacillus</keyword>
                                                            
                                <keyword>Bacillus amyloliquefaciens</keyword>
                                                            
                                <keyword>Bacillus subtilis</keyword>
                                                            
                                <keyword>bacteria</keyword>
                                                            
                                <keyword>Bacterial contamination</keyword>
                                                            
                                <keyword>bacterial pathogens</keyword>
                                                            
                                <keyword>Bacterial vaginosis</keyword>
                                                            
                                <keyword>bacteriological quality</keyword>
                                                            
                                <keyword>Bacteriophage therapy</keyword>
                                                            
                                <keyword>BG-11</keyword>
                                                            
                                <keyword>Bioactive compounds</keyword>
                                                            
                                <keyword>Biochar</keyword>
                                                            
                                <keyword>biocontrol</keyword>
                                                            
                                <keyword>Biodiesel</keyword>
                                                            
                                <keyword>biodiversity conservation</keyword>
                                                            
                                <keyword>Bioethanol</keyword>
                                                            
                                <keyword>biofertilizer</keyword>
                                                            
                                <keyword>Biofertilizers</keyword>
                                                            
                                <keyword>Bioremediation</keyword>
                                                            
                                <keyword>biosynthesis</keyword>
                                                            
                                <keyword>biotransformation</keyword>
                                                            
                                <keyword>Botanical garden</keyword>
                                                            
                                <keyword>Capsella bursa-pastoris</keyword>
                                                            
                                <keyword>carbapenem resistance</keyword>
                                                            
                                <keyword>carbon sequestration</keyword>
                                                            
                                <keyword>Cassava peel</keyword>
                                                            
                                <keyword>cells growth phase</keyword>
                                                            
                                <keyword>Cerebral Malaria</keyword>
                                                            
                                <keyword>Chetawala Ghat</keyword>
                                                            
                                <keyword>Childbearing</keyword>
                                                            
                                <keyword>Chlamydomonasreinhardtii</keyword>
                                                            
                                <keyword>Chromatography</keyword>
                                                            
                                <keyword>chronic inflammation</keyword>
                                                            
                                <keyword>Circular agriculture</keyword>
                                                            
                                <keyword>Circular economy</keyword>
                                                            
                                <keyword>Climate Change</keyword>
                                                            
                                <keyword>climate change adaptation</keyword>
                                                            
                                <keyword>climate change mitigation</keyword>
                                                            
                                <keyword>Coastal sediment</keyword>
                                                            
                                <keyword>Community-Acquired UTIs (CA-UTIs)</keyword>
                                                            
                                <keyword>Compost</keyword>
                                                            
                                <keyword>Concentration</keyword>
                                                            
                                <keyword>conventional antibiotics</keyword>
                                                            
                                <keyword>crop protection</keyword>
                                                            
                                <keyword>Crude oil</keyword>
                                                            
                                <keyword>Crude oil contamination</keyword>
                                                            
                                <keyword>Cryptosporidium</keyword>
                                                            
                                <keyword>Culture</keyword>
                                                            
                                <keyword>Cyanobacteria</keyword>
                                                            
                                <keyword>Cyclic lipopeptides</keyword>
                                                            
                                <keyword>Dacryodes edulis</keyword>
                                                            
                                <keyword>Diabetes mellitus</keyword>
                                                            
                                <keyword>diabetic patients</keyword>
                                                            
                                <keyword>Disease</keyword>
                                                            
                                <keyword>drug solubility</keyword>
                                                            
                                <keyword>Drug-resistant pathogens</keyword>
                                                            
                                <keyword>E-waste</keyword>
                                                            
                                <keyword>E-waste recycling</keyword>
                                                            
                                <keyword>E. coli</keyword>
                                                            
                                <keyword>E. coli retention</keyword>
                                                            
                                <keyword>Ear cleaning</keyword>
                                                            
                                <keyword>EBV</keyword>
                                                            
                                <keyword>ecological balance</keyword>
                                                            
                                <keyword>Ecological Benefits</keyword>
                                                            
                                <keyword>effluents</keyword>
                                                            
                                <keyword>electronic waste</keyword>
                                                            
                                <keyword>Electronic waste management</keyword>
                                                            
                                <keyword>Elisa</keyword>
                                                            
                                <keyword>enteric bacteria</keyword>
                                                            
                                <keyword>Environment</keyword>
                                                            
                                <keyword>Environmental</keyword>
                                                            
                                <keyword>environmental contamination</keyword>
                                                            
                                <keyword>environmental impact</keyword>
                                                            
                                <keyword>Environmental Sustainability</keyword>
                                                            
                                <keyword>erythromycin</keyword>
                                                            
                                <keyword>Escherichia coli</keyword>
                                                            
                                <keyword>extension</keyword>
                                                            
                                <keyword>Fabaceae</keyword>
                                                            
                                <keyword>Feathers</keyword>
                                                            
                                <keyword>Female Genital Mutilation</keyword>
                                                            
                                <keyword>Fengycin</keyword>
                                                            
                                <keyword>Fermentation</keyword>
                                                            
                                <keyword>Ficussycamorus</keyword>
                                                            
                                <keyword>filamentous fungi</keyword>
                                                            
                                <keyword>Fish</keyword>
                                                            
                                <keyword>Food</keyword>
                                                            
                                <keyword>food ingredients</keyword>
                                                            
                                <keyword>food microbiology</keyword>
                                                            
                                <keyword>food safety</keyword>
                                                            
                                <keyword>Foodborne illnesses</keyword>
                                                            
                                <keyword>forest ecosystems</keyword>
                                                            
                                <keyword>fractions</keyword>
                                                            
                                <keyword>functional foods</keyword>
                                                            
                                <keyword>Fungal Contamination</keyword>
                                                            
                                <keyword>fungal pathogens</keyword>
                                                            
                                <keyword>fungi</keyword>
                                                            
                                <keyword>Ganga Khadar</keyword>
                                                            
                                <keyword>genetic resistance</keyword>
                                                            
                                <keyword>genotyping</keyword>
                                                            
                                <keyword>Germination</keyword>
                                                            
                                <keyword>Gram-negative bacteria</keyword>
                                                            
                                <keyword>Gram-positive bacteria</keyword>
                                                            
                                <keyword>Grass</keyword>
                                                            
                                <keyword>Green algae</keyword>
                                                            
                                <keyword>Groundwater depletion</keyword>
                                                            
                                <keyword>Growth</keyword>
                                                            
                                <keyword>Gut Microbiota</keyword>
                                                            
                                <keyword>health risk</keyword>
                                                            
                                <keyword>Heavy metals</keyword>
                                                            
                                <keyword>Helicobacter pylori</keyword>
                                                            
                                <keyword>hepatitis C</keyword>
                                                            
                                <keyword>Hepatotoxicity</keyword>
                                                            
                                <keyword>Herbal</keyword>
                                                            
                                <keyword>heterocyclic compounds</keyword>
                                                            
                                <keyword>HIV patients</keyword>
                                                            
                                <keyword>home garden</keyword>
                                                            
                                <keyword>Honeybee-derived honey</keyword>
                                                            
                                <keyword>hospital equipment</keyword>
                                                            
                                <keyword>Hospital-Acquired UTIs (HA-UTIs)</keyword>
                                                            
                                <keyword>houseflies</keyword>
                                                            
                                <keyword>HPV</keyword>
                                                            
                                <keyword>Human health</keyword>
                                                            
                                <keyword>Human Papillomavirus</keyword>
                                                            
                                <keyword>Hydrodictyon</keyword>
                                                            
                                <keyword>Hydrogen</keyword>
                                                            
                                <keyword>hydrogen peroxide</keyword>
                                                            
                                <keyword>Immune Function</keyword>
                                                            
                                <keyword>Immune modulation</keyword>
                                                            
                                <keyword>including imipenem</keyword>
                                                            
                                <keyword>Indigenous knowledge</keyword>
                                                            
                                <keyword>induced systemic resistance</keyword>
                                                            
                                <keyword>Inflammation</keyword>
                                                            
                                <keyword>innovation</keyword>
                                                            
                                <keyword>insect</keyword>
                                                            
                                <keyword>Insulin resistance</keyword>
                                                            
                                <keyword>intestinal microbiota</keyword>
                                                            
                                <keyword>Ions</keyword>
                                                            
                                <keyword>Iturin</keyword>
                                                            
                                <keyword>Ixora coccinea</keyword>
                                                            
                                <keyword>Jatropha tanjorensis</keyword>
                                                            
                                <keyword>lactic acid bacteria</keyword>
                                                            
                                <keyword>leafy vegetables</keyword>
                                                            
                                <keyword>Lyngbya bipunctata</keyword>
                                                            
                                <keyword>Lysinibacillus</keyword>
                                                            
                                <keyword>Malondialdehyde</keyword>
                                                            
                                <keyword>medicinal plants</keyword>
                                                            
                                <keyword>Meerut</keyword>
                                                            
                                <keyword>Metabolic disorders</keyword>
                                                            
                                <keyword>Metagenomics</keyword>
                                                            
                                <keyword>Metal coordination complexes</keyword>
                                                            
                                <keyword>methicillin-resistant Staphylococcus aureus</keyword>
                                                            
                                <keyword>MIC</keyword>
                                                            
                                <keyword>Microalgae</keyword>
                                                            
                                <keyword>microbes</keyword>
                                                            
                                <keyword>Microbial carbon fixation</keyword>
                                                            
                                <keyword>microbial contamination</keyword>
                                                            
                                <keyword>Microbial dysbiosis</keyword>
                                                            
                                <keyword>microbial ecology</keyword>
                                                            
                                <keyword>microbial genomics</keyword>
                                                            
                                <keyword>microbial solutions</keyword>
                                                            
                                <keyword>Microbial therapeutics</keyword>
                                                            
                                <keyword>microbial world</keyword>
                                                            
                                <keyword>Microbiological parameters</keyword>
                                                            
                                <keyword>Microbiology</keyword>
                                                            
                                <keyword>Microplastics</keyword>
                                                            
                                <keyword>Minimum Bactericidal Concentration (MBC)</keyword>
                                                            
                                <keyword>Minimum Bactericidal Index</keyword>
                                                            
                                <keyword>Minimum Fungicidal Concentration (MFC)</keyword>
                                                            
                                <keyword>minimum inhibitory concentration (MIC)</keyword>
                                                            
                                <keyword>modern environmental management</keyword>
                                                            
                                <keyword>Moringa oleifera</keyword>
                                                            
                                <keyword>multidrug resistance</keyword>
                                                            
                                <keyword>multidrug-resistant bacteria</keyword>
                                                            
                                <keyword>mycorrhizal fungi</keyword>
                                                            
                                <keyword>nanocarriers</keyword>
                                                            
                                <keyword>nanotechnology</keyword>
                                                            
                                <keyword>Nature-Based Solutions</keyword>
                                                            
                                <keyword>Neem</keyword>
                                                            
                                <keyword>neonatal infection</keyword>
                                                            
                                <keyword>Nicotiana Tabacum</keyword>
                                                            
                                <keyword>Niger Delta</keyword>
                                                            
                                <keyword>nitrogen-fixing bacteria</keyword>
                                                            
                                <keyword>non-culturable poultry</keyword>
                                                            
                                <keyword>Nutrient cycling</keyword>
                                                            
                                <keyword>nutrient recycling</keyword>
                                                            
                                <keyword>nutrient retention</keyword>
                                                            
                                <keyword>Oclansorb</keyword>
                                                            
                                <keyword>Oncogenic microbes</keyword>
                                                            
                                <keyword>Oryza sativa</keyword>
                                                            
                                <keyword>Oxygen</keyword>
                                                            
                                <keyword>parasitosis</keyword>
                                                            
                                <keyword>pathogens</keyword>
                                                            
                                <keyword>PBRs</keyword>
                                                            
                                <keyword>Pepper anthracnose</keyword>
                                                            
                                <keyword>personalized nutrition</keyword>
                                                            
                                <keyword>Pesticide residues</keyword>
                                                            
                                <keyword>PGPR</keyword>
                                                            
                                <keyword>phage cocktails</keyword>
                                                            
                                <keyword>pharmaceutical cocrystals</keyword>
                                                            
                                <keyword>phosphate-solubilizing fungi</keyword>
                                                            
                                <keyword>Physico-chemical parameters</keyword>
                                                            
                                <keyword>Physicochemical parameters</keyword>
                                                            
                                <keyword>physicochemical properties</keyword>
                                                            
                                <keyword>Phytochemical profiling</keyword>
                                                            
                                <keyword>phytochemicals</keyword>
                                                            
                                <keyword>Phytotherapy</keyword>
                                                            
                                <keyword>plant growth promotion</keyword>
                                                            
                                <keyword>plant immunity</keyword>
                                                            
                                <keyword>plant species</keyword>
                                                            
                                <keyword>Plasmodium falciparum</keyword>
                                                            
                                <keyword>policy frameworks</keyword>
                                                            
                                <keyword>Polymerase chain detection</keyword>
                                                            
                                <keyword>Prebiotics</keyword>
                                                            
                                <keyword>Precision fermentation</keyword>
                                                            
                                <keyword>Predictions</keyword>
                                                            
                                <keyword>Pregnant women</keyword>
                                                            
                                <keyword>Probiotics</keyword>
                                                            
                                <keyword>Public Health</keyword>
                                                            
                                <keyword>public health risks</keyword>
                                                            
                                <keyword>questionnaire</keyword>
                                                            
                                <keyword>rainy and dry season</keyword>
                                                            
                                <keyword>Randia aculeata</keyword>
                                                            
                                <keyword>recycling</keyword>
                                                            
                                <keyword>reforestation</keyword>
                                                            
                                <keyword>renewable energy</keyword>
                                                            
                                <keyword>Reproductive aged women</keyword>
                                                            
                                <keyword>resource efficiency</keyword>
                                                            
                                <keyword>resource recovery</keyword>
                                                            
                                <keyword>rhizosphere</keyword>
                                                            
                                <keyword>Risk Factors</keyword>
                                                            
                                <keyword>Salmonella</keyword>
                                                            
                                <keyword>Salmonella sp</keyword>
                                                            
                                <keyword>Sand grain size</keyword>
                                                            
                                <keyword>sanitation</keyword>
                                                            
                                <keyword>Sexual Behaviors</keyword>
                                                            
                                <keyword>shelf-life</keyword>
                                                            
                                <keyword>Shigella; Salmonell</keyword>
                                                            
                                <keyword>Silviculture</keyword>
                                                            
                                <keyword>Skin</keyword>
                                                            
                                <keyword>skin penetration</keyword>
                                                            
                                <keyword>Smoked fish</keyword>
                                                            
                                <keyword>Soap</keyword>
                                                            
                                <keyword>Social Well-being</keyword>
                                                            
                                <keyword>socio-environmental factors</keyword>
                                                            
                                <keyword>Soil</keyword>
                                                            
                                <keyword>soil health</keyword>
                                                            
                                <keyword>soil microbes</keyword>
                                                            
                                <keyword>Soil microbiota</keyword>
                                                            
                                <keyword>soil restoration</keyword>
                                                            
                                <keyword>Southern Kaduna</keyword>
                                                            
                                <keyword>Spent oil. Polluted soil</keyword>
                                                            
                                <keyword>Staphylococcus aureus</keyword>
                                                            
                                <keyword>sterilized and unsterilized sand</keyword>
                                                            
                                <keyword>Sub-acute toxicity</keyword>
                                                            
                                <keyword>sustainable agriculture</keyword>
                                                            
                                <keyword>sustainable farming</keyword>
                                                            
                                <keyword>sustainable management</keyword>
                                                            
                                <keyword>sustainable waste management</keyword>
                                                            
                                <keyword>Synbiotics</keyword>
                                                            
                                <keyword>synthetic biology</keyword>
                                                            
                                <keyword>Tamarindus indica</keyword>
                                                            
                                <keyword>Tomato Fusarium wilt</keyword>
                                                            
                                <keyword>topical antifungal therapy</keyword>
                                                            
                                <keyword>Traditional Ecological Knowledge</keyword>
                                                            
                                <keyword>Traditional medicinal plants</keyword>
                                                            
                                <keyword>traditional practices</keyword>
                                                            
                                <keyword>transdermal drug delivery</keyword>
                                                            
                                <keyword>Transferosomes</keyword>
                                                            
                                <keyword>Treatment performance</keyword>
                                                            
                                <keyword>Trichoderma</keyword>
                                                            
                                <keyword>tumorigenesis</keyword>
                                                            
                                <keyword>Type 2 diabetes</keyword>
                                                            
                                <keyword>Urban Green Spaces</keyword>
                                                            
                                <keyword>Urease</keyword>
                                                            
                                <keyword>Urinary tract infections (UTIs)</keyword>
                                                            
                                <keyword>Urine</keyword>
                                                            
                                <keyword>Uropathogens</keyword>
                                                            
                                <keyword>Utilization</keyword>
                                                            
                                <keyword>Vaginal microbiome</keyword>
                                                            
                                <keyword>vancomycin</keyword>
                                                            
                                <keyword>vesicular systems</keyword>
                                                            
                                <keyword>viral oncoproteins</keyword>
                                                            
                                <keyword>Vulvovaginal Candidiasis</keyword>
                                                            
                                <keyword>Wastewater</keyword>
                                                            
                                <keyword>Water</keyword>
                                                            
                                <keyword>water contaminated percolation</keyword>
                                                            
                                <keyword>Water hyacinth</keyword>
                                                            
                                <keyword>Women</keyword>
                                                            
                                <keyword>Xylopia aethiopica</keyword>
                                                            
                                <keyword>yeast</keyword>
                                                            
                                <keyword>Zaria</keyword>
                                                            
                                <keyword>zero waste</keyword>
                                                        
                        </keywords>
                                                                </item>
        </channel>
</rss>